| |
| Home - Health_Conditions - Campylobacter Pylori | |
| Page 3 41-48 of 48 Back | 1 | 2 | 3 |
| 41. HAMAP Helicobacter Pylori (Campylobacter Pylori) Complete Proteome Species code HELPY Taxonomy Bacteria; Proteobacteria; Epsilonproteobacteria; Campylobacterales; Helicobacteraceae; Helicobacter (TaxID 210) NEWT http://www.expasy.org/sprot/hamap/HELPY.html |
| 42. Campylobacter Pylori Antigens And Uses Thereof For Detection Of Antigenic compositions are disclosed for use in diagnostic kits and the like for detecting the presence of antibodies specific for Campylobacter pylori, bacteria http://www.patents.com/campylobacter-pylori-antigens-uses-detection-campylobacte |
| 43. CAMPYLOBACTER PYLORI, GASTRIN, ACID SECRETION, AND DUODENAL ULCERS CAMPYLOBACTER PYLORI, GASTRIN, ACID SECRETION, AND DUODENAL ULCERS. By S. Levi, K. Beardshall, L.A. Desa, J. Calam http://www.thelancet.com/journals/lancet/article/PIIS0140-6736(89)90728-9/fullte |
| 44. Am J Dis Child Abstract Campylobacter PyloriAssociated Archives of Pediatrics Adolescent Medicine, a monthly professional medical journal published by the American Medical Association, publishes original, peerreviewed clinical http://archpedi.ama-assn.org/cgi/content/abstract/142/11/1149 |
| 45. Blue Poppy Gastritis Associated With Campylobacter Pylori Publisher of books and educational products about Chinese medicine and acupuncture, professional seminars, continuing education via distance learning, and herbal products http://bluepoppy.com/cfwebstorefb/index.cfm?fuseaction=feature.display&featu |
| 46. Effects Of Topical Anesthetic Agents On Campylobacter Pylori Effects of Topical Anesthetic Agents on Campylobacter pylori Czinn, Steven J.; Carr, Howard S.; Speck, William T. http://journals.lww.com/jpgn/Abstract/1989/07000/Effects_of_Topical_Anesthetic_A |
| 47. DNA Oligomers For Use In Detection Of Campylobacter Pylori And This invention provides a DNA oligomer having the sequence 5'GGACATAGGCTGATCTCTTAGC3' (SEQ ID NO 1) and which is complementary to Campylobacter pylori 16S http://www.patents.com/dna-oligomers-detection-campylobacter-pylori-methods-usin |
| 48. Ulcers Caused By Bacteria? New Concept In Gastroenterology Ulcers caused by bacteria? New concept in gastroenterology. (Campylobacter pylori) find Medical Update articles. div id= bedoc-text ULCERS CAUSED BY BACTERIA? NEW CONCEPT http://www.highbeam.com/doc/1G1-8001147.html |
| Page 3 41-48 of 48 Back | 1 | 2 | 3 |
